View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4874_high_6 (Length: 254)
Name: NF4874_high_6
Description: NF4874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4874_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 29879564 - 29879326
Alignment:
| Q |
1 |
tggacttgtgctgttgttgctgttgctatgacttgtctgaggagaggaatcaaaaggggacatgnnnnnnnnnnnnggaaaaaatgttgttatgtttctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29879564 |
tggacttgtgctgttgttgctgttgctatgacttgtctgaggagaggaatcaaaaggggacatgttttttttttt-ggaaaaaatgttgttatgtttctc |
29879466 |
T |
 |
| Q |
101 |
tagagagagaactatgtgatatgtgattttaatatatctaaaaactttgctttcaaatccaacagaacatagataaaaagagagatgcaaatgctactaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29879465 |
tagagagagaactatgtgatatgtgattttaatatatctaaaagctttgctttcaaatccaacagaacatagataaaaagagagatgcaaatgctactaa |
29879366 |
T |
 |
| Q |
201 |
tctttgcagcatctgtatagttgccactgttgttattatt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29879365 |
tctttgcagcatctgtatagttgccactgttgttattatt |
29879326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University