View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4876_low_5 (Length: 251)
Name: NF4876_low_5
Description: NF4876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4876_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 33 - 242
Target Start/End: Original strand, 18642696 - 18642905
Alignment:
| Q |
33 |
aaaattaaaacatgtttcaaatctcattaagtcattcaacttaatgttacgtatccatgaccaagaaaccaaagcaactaaaagaccttttgttgtatta |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18642696 |
aaaattaaaacatgtttcaaatctcattaagtcattcaacttaatgttacgtatccatgaccaagaaaccaaagcaactaaaagaccttttgttgtatta |
18642795 |
T |
 |
| Q |
133 |
ctagagccatctgtgaccgggatcttcagtatactgcactggatagaggacagctaagatctaacctgcaaccaaagtacagtgattcacatctaaacat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18642796 |
ctagagccatctgtgaccgggatcttcagtatactgcactggatagaggacagcaaagatctaacctgcaaccaaagtacagtgattcacatctaaacat |
18642895 |
T |
 |
| Q |
233 |
atagaataat |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
18642896 |
atagaataat |
18642905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University