View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4878_high_13 (Length: 201)
Name: NF4878_high_13
Description: NF4878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4878_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 30050816 - 30050929
Alignment:
| Q |
18 |
gaattatttaacattaaatcaatggttaagtatatggtacataaaaagattctggctgatgttgcatttaagtttgatacacaaattctatgatttatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30050816 |
gaattatttaacattaaatcaatggttaagtatatggtacataaaaagattctggctgatgttgcatttaagtttgatacacaaattctatgatttatgt |
30050915 |
T |
 |
| Q |
118 |
atgctaaatgccaa |
131 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30050916 |
atgctaaatgccaa |
30050929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 128 - 181
Target Start/End: Original strand, 30050982 - 30051035
Alignment:
| Q |
128 |
ccaagctaaacgtaacacagctggggagttttggttatttgtttgcttactgct |
181 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30050982 |
ccaagctaaacgtaacacagctggagagttttggttatttgtttgcttactgct |
30051035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University