View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4879-Insertion-14 (Length: 63)
Name: NF4879-Insertion-14
Description: NF4879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4879-Insertion-14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 44; Significance: 7e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 7e-17
Query Start/End: Original strand, 7 - 50
Target Start/End: Original strand, 13473869 - 13473912
Alignment:
| Q |
7 |
aaattcatgtcttcttttcttcacgcttttagtacttttccgtc |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13473869 |
aaattcatgtcttcttttcttcacgcttttagtacttttccgtc |
13473912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 25523834 - 25523794
Alignment:
| Q |
7 |
aaattcatgtcttcttttcttcacgcttttagtacttttcc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
25523834 |
aaattcatgtcttcttttcttcacgctttcagtacatttcc |
25523794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University