View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4879-Insertion-8 (Length: 375)
Name: NF4879-Insertion-8
Description: NF4879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4879-Insertion-8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 8 - 375
Target Start/End: Original strand, 42935538 - 42935908
Alignment:
| Q |
8 |
aacttagagatctcttgcaccattttctcatcactttcagccacatgaatctcctctccaccaattagattcattagaaacttaacttgtcccaactctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935538 |
aacttagagatctcttgcaccattttctcatcactttcagccacatgaatctcctctccaccaattagattcattagaaacttaacttgtcccaactctt |
42935637 |
T |
 |
| Q |
108 |
gttccaagctctctttcaacacattcaacgttgccaacgtagcttcgcggttcttaacaacaccaccaacattttcatgatca---acatcagtagtatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
42935638 |
gttccaagctctctttcaacacattcaacgttgccaacgtagcttcacggttcttaacaacaccaccgacattttcatgatcaaccacatcagaagtatt |
42935737 |
T |
 |
| Q |
205 |
ggtctttggctccatcacagttcctgatgctgtaacaacatcatcctcttggatcactttttcttcttcgaaccgaacttgtttcacaacttcatcatct |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935738 |
ggtctttggctccatcacagttcctgatgctgtaacaacagcatcctcttggatcactttttcttcttcgaaccgaacttgtttcacaacttcatcatct |
42935837 |
T |
 |
| Q |
305 |
ttgctttgatcctttgggaatacaggcacaagttccaatccatcttcattgaaattccagccactgattct |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935838 |
ttgctttgatcctttgggaatacaggcacaagttccaatccatcttcattgaaattccagccactgattct |
42935908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University