View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4879_high_1 (Length: 394)
Name: NF4879_high_1
Description: NF4879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4879_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 119 - 361
Target Start/End: Original strand, 39945106 - 39945348
Alignment:
| Q |
119 |
atttcttcttcataataagtttatagtgtgggtattggcgattttgatgatagttgcaatcacatgtatgttgcttacatacatgtgggcgttgggatta |
218 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39945106 |
atttcctcttcataataagtttatagtgtgggttttggcggttttgatgatagttgcaatcacatgtatgttgcttacatacatgtgggcgttgggatta |
39945205 |
T |
 |
| Q |
219 |
gttagtcctaatcacattttctatagaattcgtgatttaggttttatcttggttggaatttggtctttcttactttttgttgtttgtttgattcaaatag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39945206 |
gttagtcctaatcacattttctatagaattcgtgatttaggttttatcttggttggaatttggtctttcttactttttgttgtttgtttgattcaaatag |
39945305 |
T |
 |
| Q |
319 |
ctagaattgtgttttgggttaggtctagatgcaggtcctcgtc |
361 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
39945306 |
ctagaattgtgttttgggttaggtctaaacgcaggtcctcgtc |
39945348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 250
Target Start/End: Original strand, 39954219 - 39954304
Alignment:
| Q |
165 |
atgatagttgcaatcacatgtatgttgcttacatacatgtgggcgttgggattagttagtcctaatcacattttctatagaattcg |
250 |
Q |
| |
|
|||||| |||| |||||| |||||||| |||||||||||||| | ||||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
39954219 |
atgataattgctgtcacattcatgttgctcacatacatgtgggcacttggattgattagtcctaatcatgtttgctatagaattcg |
39954304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 80 - 128
Target Start/End: Original strand, 8931362 - 8931410
Alignment:
| Q |
80 |
tcattcccaataccttcaacaacaccaacaccattcacaatttcttctt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931362 |
tcattcccaataccttcaacaacaccaacaccattcacaatttcttctt |
8931410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University