View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4879_high_10 (Length: 254)
Name: NF4879_high_10
Description: NF4879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4879_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 5737306 - 5737215
Alignment:
| Q |
19 |
catgtacaatattgccttttggacatttgagatttcaaccaatttatctatcaattttactttgctttaaagaggtgtgaagtcatggacctt |
111 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5737306 |
catgcacaatattgc-ttttggacatttgagattacaaccaatttatctatcaattttactttgctttaaagaggtgtgaagtcatggacctt |
5737215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University