View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4879_high_13 (Length: 238)
Name: NF4879_high_13
Description: NF4879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4879_high_13 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 39944756 - 39944975
Alignment:
| Q |
19 |
agcatagctaatgaacaacatgaacacaatagatgggacagggttgagagtttctgcaataaatacctgataaaccaaggttattggatagataaaaaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944756 |
agcatagctaatgaacaacatgaacacaatagatgggacagggttgagagtttctgcaataaatacctgataaaccaaggttattggatagataaaaaga |
39944855 |
T |
 |
| Q |
119 |
caagagaacaattaatggtagcagcaactgtgattgcaactatgacttttcagtcagtaattagtccaccgggcggtgtttggcaagaagatacaacaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944856 |
caagagaacaattaatggtagcagcaactgtgattgcaactatgacttttcagtcagtaattagtccaccgggcggtgtttggcaagaagatacaacaaa |
39944955 |
T |
 |
| Q |
219 |
aggtggttatgcttgtcctg |
238 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
39944956 |
aggtggttacgcttgtcctg |
39944975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 93 - 214
Target Start/End: Original strand, 39949175 - 39949296
Alignment:
| Q |
93 |
ccaaggttattggatagataaaaagacaagagaacaattaatggtagcagcaactgtgattgcaactatgacttttcagtcagtaattagtccaccgggc |
192 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||||| ||||||||||||||||| || ||||| ||||| ||||| |||||||| |||||||| ||| |
|
|
| T |
39949175 |
ccaaggtaattggattgataaaaagacaaaagaacaatccatggtagcagcaactgtaatcgcaacaatgacatttcaatcagtaataagtccaccaggc |
39949274 |
T |
 |
| Q |
193 |
ggtgtttggcaagaagatacaa |
214 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39949275 |
ggtgtttggcaagaagatacaa |
39949296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 213
Target Start/End: Complemental strand, 29671593 - 29671522
Alignment:
| Q |
142 |
gcaactgtgattgcaactatgacttttcagtcagtaattagtccaccgggcggtgtttggcaagaagataca |
213 |
Q |
| |
|
|||||||| ||||| || ||||||||||| || | ||| |||||||| || ||||||||||||||| ||||| |
|
|
| T |
29671593 |
gcaactgtaattgccacaatgacttttcaatccgcaataagtccaccaggtggtgtttggcaagaaaataca |
29671522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University