View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4879_high_14 (Length: 236)
Name: NF4879_high_14
Description: NF4879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4879_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 5 - 223
Target Start/End: Complemental strand, 52760929 - 52760714
Alignment:
| Q |
5 |
gaaagaattctatttcgtgctactagaggaaatgtttttctgaagcaggctgtggttgaacatcatgttctagatcctttgtcgggagagaaggttactc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52760929 |
gaaagaattctatttcgtgctactagaggaaatgtttttctgaagcaggctgtggttgaacatcatgttctagatcctttgtcgggagagaaggttactc |
52760830 |
T |
|
| Q |
105 |
attctaaagtctctaattaattactttcgttccaattagtaattagtcttctatgctcatcagtcactaatactttcttaatcttctaccttttacaggt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52760829 |
attctaaagtctctaattaattactttcgttccaattag---ttagtcttctatgctcatcagtcactaatactttcttaatcttctaccttttacaggt |
52760733 |
T |
|
| Q |
205 |
tcataaaaatgtatttatt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
52760732 |
tcataaaaatgtatttatt |
52760714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University