View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4879_high_8 (Length: 261)
Name: NF4879_high_8
Description: NF4879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4879_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 8 - 246
Target Start/End: Complemental strand, 23071846 - 23071608
Alignment:
| Q |
8 |
agataatactcaatgatgcaactcaaatgtgtcacaattttgaagtttgatatttcgattttagtagatgatggtatggttgcaacttgcaatcaaattt |
107 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23071846 |
agattatattcaatgatgcaactcaaatgtgtcacaattttgaagtttgatatttcgattttagtagatgatggtatggttgcaactggcaatcaaattt |
23071747 |
T |
|
| Q |
108 |
tgtgtaagtgcatgtgtgcctgcctatttcttaatattgctaagtattccatagtcctttaaaatcaattattccctaatccatagtaagttatgcatct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23071746 |
tgtgtaagtgcatgtgtgcctgcctatttcttaatattgctaagtattccatagtcctttaaaatcaattattccctaatccatagtaagttatgcatct |
23071647 |
T |
|
| Q |
208 |
agaaatttcccttacttctctgttacatatgcagtagtt |
246 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23071646 |
agaaatttcccttacttctgtgttacatatgcagtagtt |
23071608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 63
Target Start/End: Complemental strand, 23095943 - 23095897
Alignment:
| Q |
17 |
tcaatgatgcaactcaaatgtgtcacaattttgaagtttgatatttc |
63 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
23095943 |
tcaatgatgcatttcaaatgtgtcacaattttgaagtttgatgtttc |
23095897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 63
Target Start/End: Complemental strand, 23127638 - 23127592
Alignment:
| Q |
17 |
tcaatgatgcaactcaaatgtgtcacaattttgaagtttgatatttc |
63 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| |||| |
|
|
| T |
23127638 |
tcaatgatgcagctcaaatgtgtcacaattttaaagtttgatgtttc |
23127592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University