View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4880-Insertion-7 (Length: 262)
Name: NF4880-Insertion-7
Description: NF4880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4880-Insertion-7 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 7 - 262
Target Start/End: Complemental strand, 10032520 - 10032265
Alignment:
| Q |
7 |
aatcttttcatctgcaccgtcaaaactaagaccggaaccagaaccattactcccggtcttcaccataaccttaccatcgttttcaaagcttgacggaagc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10032520 |
aatcttttcatctgcaccgtcaaaactaagaccggaaccagaaccattactcccggtcttcaccataaccttaccatcgttttcaaagcttgacggaagc |
10032421 |
T |
|
| Q |
107 |
acctgaggaccgccacacgagaaccgtactttcaccgttttacgcgatgaattcaattcaacttcgccaacaccaccattatttgtaacttcactgttcc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10032420 |
acctgaggaccgccacacgagaaccgtactttcaccgttttacgcgatgaattcaattcaacttcgccaacaccaccattatttgtaacttcactgttcc |
10032321 |
T |
|
| Q |
207 |
atgaagcagaaccagtgtcaaaatccacttcagaattaaacccattcactttatgc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||| |
|
|
| T |
10032320 |
atgaagcagaaccagtgtcaaaatccacttcaggattaaacccatccaccttatgc |
10032265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University