View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4880_low_1 (Length: 355)
Name: NF4880_low_1
Description: NF4880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4880_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-109; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 101 - 309
Target Start/End: Original strand, 2129040 - 2129248
Alignment:
| Q |
101 |
cgtgcaagggaaagagcaccttgtgaaagctgaggttattcccaaattcaccggcgagttccttaactctgtgaatggcaacttctgaggaattatcaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2129040 |
cgtgcaagggaaagagcaccttgtgaaagctgaggttattcccaaattcaccggcgagttccttaactctgtgaatggcaacttctgaggaattatcaag |
2129139 |
T |
 |
| Q |
201 |
attatcaacgacgacggacttgaaaccaccgagtaagagttgaagaacggtgtggctaccaatgtaaccggcaccaccggtaacgagtaccgttttgttg |
300 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2129140 |
attatcaacgacgatggacttgaaaccaccgagtaagagttgaagaacggtgtggctaccaatgtaaccggcaccaccggtaacgagtacggttttgttg |
2129239 |
T |
 |
| Q |
301 |
ttcatgata |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
2129240 |
ttcatgata |
2129248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 111 - 299
Target Start/End: Original strand, 2133309 - 2133497
Alignment:
| Q |
111 |
aaagagcaccttgtgaaagctgaggttattcccaaattcaccggcgagttccttaactctgtgaatggcaacttctgaggaattatcaagattatcaacg |
210 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||| | ||||||||||||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
2133309 |
aaagagcaccttgtgaaaattgaggtttttcccaaattcagcagcgagttccttaactctacgaacagcaacttcagaggaattatcaagattatcaacg |
2133408 |
T |
 |
| Q |
211 |
acgacggacttgaaaccaccgagtaagagttgaagaacggtgtggctaccaatgtaaccggcaccaccggtaacgagtaccgttttgtt |
299 |
Q |
| |
|
| ||| | |||||||| ||||||||||| |||||||||||||||||||| |||||||||||||| |||||||| || || |||||||| |
|
|
| T |
2133409 |
atgacagttttgaaaccgccgagtaagagctgaagaacggtgtggctaccgatgtaaccggcaccgccggtaactagaacggttttgtt |
2133497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 15 - 54
Target Start/End: Original strand, 2128954 - 2128993
Alignment:
| Q |
15 |
aataaaaacagcaataacaaattggagaaccttaatccac |
54 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
2128954 |
aataaaaacagcaagaacaaattggagaacctaaatccac |
2128993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University