View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4880_low_5 (Length: 251)
Name: NF4880_low_5
Description: NF4880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4880_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 244
Target Start/End: Complemental strand, 2129580 - 2129347
Alignment:
| Q |
9 |
agcagagaagctatcacaagatgttgaattgaataatacatgtatatgccaatgtcttataattcagcgttgaatggaaaaatgagnnnnnnncagccaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2129580 |
agcagagaagctatcacaagatgttgaattgaataatacatgtat--gccaatgtcttataattcagcgttgaatggaaaaatgagaaaaaaacagccaa |
2129483 |
T |
 |
| Q |
109 |
aagtaaatccaaaggtgagaagtaagatttagatctaggagtataaactagtcagcgctgtagaaaatggactaacaacgagtctctttcacacaacagc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2129482 |
aagtaaatccaaaggtgagaagtaagatttagttctaggagtataaactagtcagcgctgtagagaatggaccaacaacgagtctctttcacacaacagc |
2129383 |
T |
 |
| Q |
209 |
acagtgacaaaggattattcaaattcacaatcatca |
244 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2129382 |
acagtgacaaaggattattcatattcacaatcatca |
2129347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University