View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4882-Insertion-5 (Length: 285)
Name: NF4882-Insertion-5
Description: NF4882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4882-Insertion-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 8 - 257
Target Start/End: Complemental strand, 29101468 - 29101219
Alignment:
| Q |
8 |
aactctacgtactttatattaacattctattgatgctatgcttcttgtatgttccttcgtctcttccacattgccatgcatgcatggatgcatttcacac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29101468 |
aactctacgtactttatattaacattctattgatgctatgcttcttgtatgttccttcgtctcttccacattgccatgcatgcatggatgcatttcacac |
29101369 |
T |
|
| Q |
108 |
tttgttttggattaagaatctgcattgacgtgcatgaggaaatcaattccttagccaacaaacataacttaatttggcggctgttcctaactcaacaaac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29101368 |
tttgttttggattaagaatctgcattgacgtgcatgaggaaatcaattccttagccaacaaacataacttaatttggcggctgttcctaactcaacaaac |
29101269 |
T |
|
| Q |
208 |
gaccctttcacatttctttttgtatgttgcccaacttgcccttcattctc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29101268 |
gaccctttcacatttctttttgtatgttgcccaacttgcccttcattctc |
29101219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University