View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4882_high_7 (Length: 235)
Name: NF4882_high_7
Description: NF4882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4882_high_7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 235
Target Start/End: Complemental strand, 42973864 - 42973642
Alignment:
| Q |
16 |
agtatttgacgggagttctctgattctatttacctgaaacacattatcaatgtatcagtaaacaacccaaatattcaatttcggggtagtagtaatgtat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42973864 |
agtatttgacgggagttctctgattctatttacctgaaacacattatcaatgtatcagtaaacaacccaaatattcaatttcggggtagtaataatgtat |
42973765 |
T |
 |
| Q |
116 |
cttttttatgaataa---taatgctttagtgacttattgagcgttaattaattacgcctttgtttggttccgtgtttgctaccaaattctcgcattgcaa |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42973764 |
cttttttatgaataataataatgctttagtgacttattgagcgttaattaattacgcctttgtttggttccgtgtttgctaccaaattctcgcattgcaa |
42973665 |
T |
 |
| Q |
213 |
tgactgatctactgtgaattcct |
235 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
42973664 |
tgactgatctaccgtgaattcct |
42973642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University