View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4882_low_7 (Length: 240)
Name: NF4882_low_7
Description: NF4882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4882_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 42973556 - 42973327
Alignment:
| Q |
1 |
tgtatgttttacttttggaagagtgtagaatcaattttaacatgtttggttgctttatgagcattatttattgctagattttaaatcttgtgattctaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42973556 |
tgtatgttttacttttggaagagtgtagaatcaattttaacatgtttggttgctttatgagcattatttattgctagattttaaatcttgtgattctaga |
42973457 |
T |
 |
| Q |
101 |
aacattttgactcgagttttggttcaactcatacttatacttctacatgaacatatccaaaatataaatcactttaccttcaacccacttttagacaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42973456 |
aacattttgactcgagttttggttcaactcatacttctacttctacatgaacatatccaaaatataaatcactttaccttcaacccacttttagacaatc |
42973357 |
T |
 |
| Q |
201 |
aatttcatgtagtgcgtgtttggttctgtg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42973356 |
aatttcatgtagtgcgtgtttggttctgtg |
42973327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 194
Target Start/End: Original strand, 40491655 - 40491709
Alignment:
| Q |
139 |
acttctacatgaacatatccaaaatataaatcactttaccttcaacccacttttag |
194 |
Q |
| |
|
|||| |||||||| ||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
40491655 |
acttttacatgaatgtatccaaaa-ataaatcactttaccttcaactcacttttag |
40491709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University