View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4883-Insertion-5 (Length: 371)
Name: NF4883-Insertion-5
Description: NF4883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4883-Insertion-5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 1e-75; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 8 - 171
Target Start/End: Complemental strand, 21978368 - 21978205
Alignment:
| Q |
8 |
ctatccatggcaagtacgtaaggaaagagattaacccgttaaatagatctctgttacctagaggggataaatatcctggtctccatagttgcacgcggag |
107 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21978368 |
ctatctatggcaaggacgtaaggaaagagattaaccccttaaatagatctctgttatctagaggggataaatatcctggtctccatagttgcacgcggag |
21978269 |
T |
|
| Q |
108 |
gatatatttggttacaaaatataaaatcaaagtctctacactttcttcaatgaataaagctaac |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21978268 |
gatatatttggttacaaaatataaaatcaaagtctctacactttcttcaatgaagaaagctaac |
21978205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 235 - 370
Target Start/End: Complemental strand, 21978113 - 21977978
Alignment:
| Q |
235 |
gatgacagattgctttaggagacatagtataaatggtttcttctattgtgatgatgtgaaggacttatgcttactctccttgcttgcaatgttcttctct |
334 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
21978113 |
gatgacagattgctttagaagacatagtataaatggtttcttctattgtgatgatgtgaaggacttatgcttactctccttgcttgcaatgttcctttct |
21978014 |
T |
|
| Q |
335 |
cttttaatattcagtcttgataggatttcaatttta |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
21978013 |
cttttaatattcagtcttgataggatttcaatttta |
21977978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 196 - 239
Target Start/End: Complemental strand, 21978179 - 21978136
Alignment:
| Q |
196 |
aagaggaaccatccttttaaatctggggacagattgcacgatga |
239 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
21978179 |
aagaggaaccattcttttaaatctgggaacagattgcacgatga |
21978136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 278 - 326
Target Start/End: Original strand, 50680275 - 50680323
Alignment:
| Q |
278 |
tattgtgatgatgtgaaggacttatgcttactctccttgcttgcaatgt |
326 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50680275 |
tattgtgatgatgtgaaggacttctgcttactctccttgcttgcaatgt |
50680323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University