View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4883_low_1 (Length: 525)
Name: NF4883_low_1
Description: NF4883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4883_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 236 - 511
Target Start/End: Original strand, 46694848 - 46695123
Alignment:
| Q |
236 |
aaagaaaccacaacgtcgcggtgcaccggcgacacaacaagagggtggtgtcaccttgaaggcaaagcaccaccaccaccgatctacatcttggcagaaa |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46694848 |
aaagaaaccacaacgtcgcggtgcaccggcgacacaacaagagggtggtgtcaccttgaaggcaaagcaccaccaccaccgatctacatcttggcagaaa |
46694947 |
T |
|
| Q |
336 |
gatattggatttggaagggagaaaggtatcagcgggtgtgagcttttctagtgagaagggagagcnnnnnnnctagagagagaaaagggtgataaatata |
435 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
46694948 |
gatattggatttggaagggagaaaggtatcggcaggtgtgagcttttctagagagaagggagagctttttttctcgagagagaaaagggtgataaatata |
46695047 |
T |
|
| Q |
436 |
tgtgacaccaatactacatttatggaccatttcaaatcatgtctatctttgtgcaaccatctcaagtgttactttt |
511 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46695048 |
tgtgacaccaatactacatttatggaccatttcaaatcatgtctatctttgtgcaaccatcttaagtgttactttt |
46695123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 98 - 222
Target Start/End: Original strand, 46694692 - 46694816
Alignment:
| Q |
98 |
tgaccgtacccacccatatagaaacaaagaaggagacatggtcaacaataaacacaaacccaacaacctaaaaaagtttccagatcttgaagaatgcaca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
46694692 |
tgaccgtacccacccatatagaaacaaagaaggcgacatggtcaacaataaacacaaacccaataacctaaaaaagtatccagatcttgaagaaagcaca |
46694791 |
T |
|
| Q |
198 |
caaccaaaacaagcttccagatctg |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46694792 |
caaccaaaacaagcttccagatctg |
46694816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 236 - 400
Target Start/End: Original strand, 20114272 - 20114438
Alignment:
| Q |
236 |
aaagaaaccacaacgtcgcggtgcaccggcgacacaacaagagggtggtgtcaccttgaaggcaaa-gcaccaccaccaccg-atctacatcttggcaga |
333 |
Q |
| |
|
|||||||||| | | |||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||| | ||||||||||||||||| |
|
|
| T |
20114272 |
aaagaaaccaaatcatcgcggtgcaccggcgactcaacaagagggtggtgtcaccttgaagggaagcgcaccaccaccactggatctacatcttggcaga |
20114371 |
T |
|
| Q |
334 |
aagatattggatttggaagggagaaaggtatcagcgggtgtgagcttttctagtgagaagggagagc |
400 |
Q |
| |
|
||| ||||||||||||||||||||||||| || | |||||||||||||||||| ||||||| ||||| |
|
|
| T |
20114372 |
aaggtattggatttggaagggagaaaggtctctgtgggtgtgagcttttctagagagaaggcagagc |
20114438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 131 - 184
Target Start/End: Original strand, 20114191 - 20114244
Alignment:
| Q |
131 |
agacatggtcaacaataaacacaaacccaacaacctaaaaaagtttccagatct |
184 |
Q |
| |
|
||||| ||||||||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
20114191 |
agacagggtcaacaacaaacacaaacccaaccacctaaaaaaccttccagatct |
20114244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 46694593 - 46694621
Alignment:
| Q |
1 |
aaggcttatggcttatggttagaggcaag |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46694593 |
aaggcttatggcttatggttagaggcaag |
46694621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University