View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4883_low_4 (Length: 257)
Name: NF4883_low_4
Description: NF4883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4883_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 25180411 - 25180617
Alignment:
| Q |
1 |
tgatgagcttgtagaattgtgtttctgccatataataagaaactaactaatccttacaggttagaacatgactaggaaaattaagacttaatagagaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
25180411 |
tgatgagcttgtagaattgtgtttctgccatataataagaaactaactaatccttacaggttagaacatgactagtaaaattaagacttaataaggaagt |
25180510 |
T |
 |
| Q |
101 |
agtttctaatatgagagttgtagttttcttatgccgt-------tgatgagtgaatcgaaagatttaaagaagttggttgataattgttagagaagctta |
193 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25180511 |
agtttctaatatgagagttgtagtttttttatgtcgttgatgactgatgagtgaatcgaaagatttaaagaagttggttgataattgttagagaagctta |
25180610 |
T |
 |
| Q |
194 |
aagcaaa |
200 |
Q |
| |
|
||||||| |
|
|
| T |
25180611 |
aagcaaa |
25180617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University