View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4883_low_5 (Length: 233)
Name: NF4883_low_5
Description: NF4883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4883_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 86
Target Start/End: Complemental strand, 31397191 - 31397115
Alignment:
| Q |
10 |
catcatcatatcatataccacaacatatattacattaccaacttattaattcaaaaatatgagcgagagaccaaaat |
86 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
31397191 |
catcatcatattatataccacaacatatattacattaccaacttattaattcaaaaatatgagcgagaaacctaaat |
31397115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 31397110 - 31397058
Alignment:
| Q |
169 |
tttgctcgtggttttttagtttggttcagtgataccaacttaattaagatgat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31397110 |
tttgctcgtggttttttagtttggttcagtgataccaacttaattaagatgat |
31397058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University