View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4884_high_7 (Length: 335)
Name: NF4884_high_7
Description: NF4884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4884_high_7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 14 - 335
Target Start/End: Complemental strand, 11911329 - 11910996
Alignment:
| Q |
14 |
agaggcttttaacttactttaatccccattttgcaaggtttgattttacaa------------ttaatatccaattgaaactttgaaatttcaaatccca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11911329 |
agaggcttttaacttactttaatccccattttgcaaggtttgattttacaaagaaccattcaattaatatccaattgaaactttgaaatttcaaatccca |
11911230 |
T |
 |
| Q |
102 |
atttacaatcctatggacaattaaacttttatggagaggcttttattttcagtttacaagttgaatttgagttatcactattcattgtgatctcttcaat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11911229 |
atttacaatcctatggacaattaaacttttatggagaggcttttattttcagtttacaagttgaatttgagttatcactattcattgtgatctcttcaat |
11911130 |
T |
 |
| Q |
202 |
ttgcagcaaccatttttccttcatggccattttgaacgttaaaactcttatgaagagtttaccgtccatttggtttcacaaaatttgaagaattagtttt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11911129 |
ttgcagcaaccatttttccttcatggccgttttgaacgttaaaactcttatggagagtttgtcgtccatttggtttcacaaaatttgaagaattagtttt |
11911030 |
T |
 |
| Q |
302 |
ttctgttgtccatagatgatacctgatttacacc |
335 |
Q |
| |
|
| || ||||||||||||||| || |||||||| |
|
|
| T |
11911029 |
tgcttgtgtccatagatgatatttggtttacacc |
11910996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University