View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4884_low_1 (Length: 362)
Name: NF4884_low_1
Description: NF4884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4884_low_1 |
 |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0045 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 50 - 346
Target Start/End: Original strand, 74391 - 74687
Alignment:
| Q |
50 |
gacgtcgttttctcaccaatccttcaaccatacaatcaaacgcgcgattctagacgccgcgcaaattcccctccgccgttcacattaaccaacatcctct |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
74391 |
gacgtcgttttctcaccaatccttcaaccatacaatcaaacgcgcgattctcgacgccgcgcaaattcccctccgccgttcacattaaccaccatcctct |
74490 |
T |
 |
| Q |
150 |
ccgccgcgatctcatggctccgacaccgacggatccgtttcatcttccttctcctctgttctcctctcctctttatcgtccttttcatcgctttcccttt |
249 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
74491 |
ccgccgcgatctcatggctccgaaaccgacggatccgtttcatcttccttctcctctgttctcctctcatctttatcttccttttcatcgctttcccttt |
74590 |
T |
 |
| Q |
250 |
cctatgcataaccgaaatctgcctccgacgtcgtttgtggagaaagcttcttcgtggtttctccggtgatgattccgccgatcggcttcgaagatgt |
346 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
74591 |
cctatgcatcaccgaaatctgcctccgacgccgtttatggagaaaacttcttcgtggattctccggtgatgattccgccgatcggcttcgaagatgt |
74687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University