View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4885-Insertion-11 (Length: 125)
Name: NF4885-Insertion-11
Description: NF4885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4885-Insertion-11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 16 - 125
Target Start/End: Original strand, 41067075 - 41067184
Alignment:
| Q |
16 |
tcgtttgatttagaaattcatcattctcatatatgagaaactttaaatttcgtctctgattattcattttagtttctgttaagacacttaggcggtatta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41067075 |
tcgtttgatttagaaattcatcattctcatatatgagaaactttaaatttcgtctctgattattcattttagtttctgttaagacacttaggcggtatta |
41067174 |
T |
 |
| Q |
116 |
ttgattttcg |
125 |
Q |
| |
|
|||||||||| |
|
|
| T |
41067175 |
ttgattttcg |
41067184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University