View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4885_low_1 (Length: 578)
Name: NF4885_low_1
Description: NF4885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4885_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 7e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 20 - 160
Target Start/End: Original strand, 10353747 - 10353887
Alignment:
| Q |
20 |
ttttgcattctatttgcttnnnnnnntgctcttaaatttaatttgatccgcctattcaaataagaacatatccnnnnnnnnnnaagtgtaatatctttaa |
119 |
Q |
| |
|
||||||||||||||||||| || |||| |||||||||||| || |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10353747 |
ttttgcattctatttgcttaaaaaaatgttcttggatttaatttgattcgtctattcaaataagaacatatcctttttcttttaagtgtaatatctttaa |
10353846 |
T |
 |
| Q |
120 |
cacctacactggttcttcttcaaaataatgacttttaaaac |
160 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10353847 |
cacctacactggttcttcttgaaaataatgacttttaaaac |
10353887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 458 - 550
Target Start/End: Original strand, 11825666 - 11825758
Alignment:
| Q |
458 |
attacttggtcgtattcttgaactttgagtttcttgacactaaccaatagaggatgatcatgttcagacatagcttggacctttagcatatat |
550 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||||||||||||||| |||||||| ||||| |||||| || ||||| | |||||||| |||| |
|
|
| T |
11825666 |
attacttggtcatattgttgaaatttgagtttcttgacactaaccagtagaggatcatcatattcagaaatggcttgaaactttagcacatat |
11825758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University