View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4885_low_4 (Length: 312)
Name: NF4885_low_4
Description: NF4885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4885_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 24 - 246
Target Start/End: Original strand, 24765305 - 24765527
Alignment:
| Q |
24 |
cacatcagttttactttcatcttgaactattatactgaacaccattttgctcccatggccatgcatatgaacatgttacaacaccaacactcatggctat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24765305 |
cacatcagttttactttcatcttgaactattatactgaacactattttgctcccatggccatgcatatgaacatgttacaacaccaacactcatggctat |
24765404 |
T |
|
| Q |
124 |
atatgccggcatatctccactaatattaggcactctttgatttgtttgcaatttaaaagtggtttaatatttatgtttgattgttctttgctacagctgg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24765405 |
atatgccggcatatctccactaatattaggcactctttgatttgtttgcaatttaaaagtggtttaatatttatgtttgatggttctttgctacagctgg |
24765504 |
T |
|
| Q |
224 |
ttcttataatgaatgattccatt |
246 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
24765505 |
ttcttataatgaatgattccatt |
24765527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 243 - 286
Target Start/End: Original strand, 24766112 - 24766155
Alignment:
| Q |
243 |
cattccgacatgacatcaacagtttggcgctattgtttgtttaa |
286 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
24766112 |
cattccgacatgacatcaacaatttggcggtattgtttgtttaa |
24766155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 168 - 237
Target Start/End: Complemental strand, 47763398 - 47763328
Alignment:
| Q |
168 |
tttgcaatttaaaagtggtttaatatttatgtttgat-tgttctttgctacagctggttcttataatgaat |
237 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
47763398 |
tttgcaatgtaaaagtggtttaatatttatgtttgatgcgtgctttgctacaactggttcttataatgaat |
47763328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University