View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4886_high_11 (Length: 306)
Name: NF4886_high_11
Description: NF4886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4886_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 44861892 - 44862180
Alignment:
| Q |
1 |
tctacctttcttcatattctcatcaaatgcttcctaattgctctttctttgtttgcagattcgcatgctggatctagtacttaagttgctgccagaagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44861892 |
tctacctttcttcatattctcatcaaatgcttcctaattgctctttctttgtttgcagattcgcatgctggatctagtacttaagttgctgccagaagac |
44861991 |
T |
 |
| Q |
101 |
tctaaggagccgcaaacagctcgcattcttctgtacaagttgttttatgatcagactgaagaagggatgactcaatttctcttgaatttgatcaaaacgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44861992 |
tctaaggagccgcaaacagctcgcattcttctgtacaagttgttttatgatcagactgaagaagggatgactcaatttctcttgaatttgatcaaaacgt |
44862091 |
T |
 |
| Q |
201 |
ttgacactcacaaacaatgcaaaaggtttcaactcttcattttaattaagaaaaacatcacattacttaaccatgaacatgcttgaaat |
289 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44862092 |
ttgacacccacaaacaatgcaaaaggtttcaactcttcattttaattaagaaaaacatcacattacttaaccatgaacatgcctgaaat |
44862180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University