View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4886_high_21 (Length: 238)

Name: NF4886_high_21
Description: NF4886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4886_high_21
NF4886_high_21
[»] chr7 (1 HSPs)
chr7 (24-222)||(40433229-40433427)


Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 24 - 222
Target Start/End: Original strand, 40433229 - 40433427
Alignment:
24 atttcccttctaataaatgaataacagctcccaaaggaaatgagagaaggctgagtaaaaaatcagcaaattctttactcactagagcatacagaatttt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40433229 atttcccttctaataaatgaataacagctcccaaaggaaatgagagaaggctgagtaaaaaatcagcaaattctttactcactagagcatacagaatttt 40433328  T
124 gtttacagannnnnnnaagaccagtgtcacactaaatttgatgtcactattgtttttaacatcacaagggaagaactgtgacatttcgagggttggttt 222  Q
    |||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
40433329 gtttacagatttttttaagaccagtgtcacactaaatttgatgtcactattgtttttaacatcacaagggaagaaccgtgacatttcgagggttggttt 40433427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University