View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4886_high_23 (Length: 225)

Name: NF4886_high_23
Description: NF4886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4886_high_23
NF4886_high_23
[»] chr3 (1 HSPs)
chr3 (17-213)||(47893928-47894124)
[»] chr2 (1 HSPs)
chr2 (51-101)||(38748172-38748222)
[»] chr8 (1 HSPs)
chr8 (33-122)||(42926175-42926264)


Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 47893928 - 47894124
Alignment:
17 attaggaaactgcaccaaaggtgattcttgccacttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaactcagctttgtaacgac 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47893928 attaggaaactgcaccaaaggtgattcttgccacttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaactcagctttgtaacgac 47894027  T
117 ggaaccctttgccggagacgagtttgtttctttgctcataccattgatcaactccgtgtctcagatagcgcttcaccggaatcatttgtttcatctc 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||    
47894028 ggaaccctttgccggagacgagtttgtttctttgctcataccattgatcaactccgtgtctcaaataacgcttcaccggaatcatttgtttcatctc 47894124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 51 - 101
Target Start/End: Complemental strand, 38748222 - 38748172
Alignment:
51 ttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaact 101  Q
    ||||||||||| |||||||||||||||||||||||| || | |||||||||    
38748222 ttcgctcatggcgtttttgaatgctggcttcatcctgctagatacagaact 38748172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 33 - 122
Target Start/End: Complemental strand, 42926264 - 42926175
Alignment:
33 aaaggtgattcttgccacttcgctcatggtgtttttgaatgctggcttcatccttctcgttacagaactcagctttgtaacgacggaacc 122  Q
    ||||||||||| ||  | || |||||||||||||| || || |||||||||||||| |||||| | |||||||  ||||| |||||||||    
42926264 aaaggtgattcgtgtgagtttgctcatggtgttttcgagtgttggcttcatccttcgcgttaccgtactcagccgtgtaaagacggaacc 42926175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University