View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4886_high_24 (Length: 219)
Name: NF4886_high_24
Description: NF4886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4886_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 49674249 - 49674392
Alignment:
| Q |
20 |
atcagttactagactgtattatatacagtagaatagaaatttgaaatttccatccttgtatagtaatttaaggaaatggatccccttcagctgctgcacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49674249 |
atcagttactagactgtattatatacagtagaatagaaatttgaaatttccatccttgtatagtaatttaaggaaatggatccccttcagctgctgcacc |
49674348 |
T |
|
| Q |
120 |
gtgcagctgctgtcggggtcaaaatacataatttagtctcaagt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49674349 |
gtgcagctgctgtcggggtcaaaatacataatttagtctcaagt |
49674392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 120 - 204
Target Start/End: Original strand, 49674391 - 49674475
Alignment:
| Q |
120 |
gtgcagctgctgtcggggtcaaaatacataatttagtctcaagtcttcactttattgcttgttttcaatttaatcggtacctttg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49674391 |
gtgcagctgctgtcggggtcaaaatacataatttagtctcaagtcttcactttattgcttgttttcaatttaatcggtacctttg |
49674475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University