View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4886_high_5 (Length: 443)
Name: NF4886_high_5
Description: NF4886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4886_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 19 - 328
Target Start/End: Original strand, 30725437 - 30725759
Alignment:
| Q |
19 |
cttacgtattcacgaagttatcaattatgtgctgcgacagaaacaacattatggcagagttatttgggattctatacagtttgcagctgattgtcgaaca |
118 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30725437 |
cttacgaattcaccaagttatcaattatgtgctgcgacagaaacaacattatggcagagttatttgggattctatacagtttgcagctgattgtcgaac- |
30725535 |
T |
|
| Q |
119 |
aaggtttgtcccatgttgtgactgaaaccgattccggggaagttttgac--------------------ttgctaatcatcgttcgtcgacttgcaattg |
198 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||| || |||||||||||| |||||| ||| |
|
|
| T |
30725536 |
aaggtttgtccaatgttgtgactgaaaccgattccggggaggttttgactattatgcagacctgttgtgttcctaatcatcgttggtcgac------ttg |
30725629 |
T |
|
| Q |
199 |
caaagatacaaatactctagttaagatgattggttgtgtggagggaacttattcctcaagnnnnnnnntcaagtcgctgacacttttgccgaagagcgtt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||| ||| |
|
|
| T |
30725630 |
caaagatacaaatactctagttaagatgattggttgtgtggagggaacttattcctcaagaaaaaaaatcaagtcgcagacacttttgccaaagagggtt |
30725729 |
T |
|
| Q |
299 |
taaacagcagatgaagatgcatatttttat |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30725730 |
taaacagcagatgaagatgcatatttttat |
30725759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 320 - 434
Target Start/End: Original strand, 30726188 - 30726299
Alignment:
| Q |
320 |
tatttttattaatgttcccatttttgctattcaacctttgaagctgataatttggatacnnnnnnnnnccaaaggttgttagtttgattcatggcgggtt |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
30726188 |
tatttttattaatgttcccatttttgctattcaacctttgaagctcataatttggatac-ttttttttccaaaggttgttagtttgattcatg--gggtt |
30726284 |
T |
|
| Q |
420 |
attctcttttgttca |
434 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30726285 |
attctcttttgttca |
30726299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University