View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4886_low_13 (Length: 300)

Name: NF4886_low_13
Description: NF4886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4886_low_13
NF4886_low_13
[»] chr3 (2 HSPs)
chr3 (1-117)||(2443331-2443447)
chr3 (200-290)||(9603400-9603490)


Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 2443447 - 2443331
Alignment:
1 tgggataaaagtgttatctttgcattagagtttgagtagattgaaaatacatgcgtcaactgctttttaaggttggttgctgtcttgtctttggggttcg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2443447 tgggataaaagtgttatctttgcattagagtttgagtagattgaaaatacatgcgtcaactgctttttaaggttggttgctgtcttgtctttggggttcg 2443348  T
101 gatgtgagctgtcctgg 117  Q
    |||||||||||||||||    
2443347 gatgtgagctgtcctgg 2443331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 200 - 290
Target Start/End: Original strand, 9603400 - 9603490
Alignment:
200 ttcatttctgtttcggtacttgagttgataatggtaggctgtgttccgctaatagtgatgtcgcttatatatggcattgtgtaggtctgtg 290  Q
    ||||||||||||||||| ||||||||  |   |||||||| ||||| | ||||||||||||||||||||||  ||||||| ||||||||||    
9603400 ttcatttctgtttcggtgcttgagttattggcggtaggctatgttcagataatagtgatgtcgcttatatactgcattgtctaggtctgtg 9603490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University