View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4886_low_16 (Length: 261)
Name: NF4886_low_16
Description: NF4886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4886_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 191
Target Start/End: Original strand, 34066923 - 34067095
Alignment:
| Q |
19 |
taccttgatctgctgctcttctggagataaaatcttttcaagtatactatctctcaatctcctaaatgacatctttcttttcaaatcttaatcaagctaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34066923 |
taccttgatctgctgctcttctggagataaaatcttttcaagtatactatctctcaatctcctaaatgacatctttcttttcaaatcttaatcaagctaa |
34067022 |
T |
|
| Q |
119 |
aacatcctgaaaatacggaagacatacaaaataagctcatactttcagatgcaagtaagtacataaaatgaaa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34067023 |
aacatcctgaaaatacggaagacatacaaaataagctcatactttcagatgcaagtaagtacataaaatgaaa |
34067095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 182 - 251
Target Start/End: Original strand, 34067362 - 34067431
Alignment:
| Q |
182 |
taaaatgaaagaaaactagaggcacaaaggagaaaaccccaacctcttcagaaagcccccatattctctg |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34067362 |
taaaatgtaagaaaactagaggcacaaaggagaacaccccaacctcgtcagaaagcccccatattctctg |
34067431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University