View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4886_low_19 (Length: 248)
Name: NF4886_low_19
Description: NF4886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4886_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 93 - 230
Target Start/End: Complemental strand, 40472480 - 40472343
Alignment:
| Q |
93 |
ttagggagaagatagaaatgagatatgaagaaatttgtggtggtctacatcttcacaatgtttgtgaccagcaaagctactacaaatttgcttcttatgc |
192 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40472480 |
ttagagagaagatagaaatgagatatgaagaaatttgtggtggtctacatcttcacaatgtttgtgaccatcaaagctactacaaatttgcttcttatgc |
40472381 |
T |
 |
| Q |
193 |
aactattttagctttcacaaagtttgttgctgtcaaaa |
230 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40472380 |
aactattttagctttcacaaagtttgttgatgtcaaaa |
40472343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University