View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4886_low_22 (Length: 237)
Name: NF4886_low_22
Description: NF4886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4886_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 32950642 - 32950841
Alignment:
| Q |
20 |
gatttattgcactttttctaacttcgatattagcaaaaccatcacatgtatctggacaaatttgctccaaatacaatttttatgtaatatttacggctag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||| ||||||||| |||||||||||| | |
|
|
| T |
32950642 |
gatttattgcactttttctaacttcgatattagcaaaatcatcacatgtatttggacaaatttgctataaatacactttttatgtcatatttacggctgg |
32950741 |
T |
 |
| Q |
120 |
aagaaatacgataaggctttgtttctgagttttgaggagaaggagggaggagttaaaatnnnnnnnnnnngcaagtgaaagaaatagatgacaatgagag |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
32950742 |
aagaaatacgataaggctttgtttctgagttttgaggggaaggagggaggagtttaaaaaaaaaaaaa---caagtgaaagaaatagatgacaatgagag |
32950838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University