View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4886_low_25 (Length: 203)

Name: NF4886_low_25
Description: NF4886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4886_low_25
NF4886_low_25
[»] chr7 (2 HSPs)
chr7 (76-185)||(48967272-48967381)
chr7 (15-78)||(48967820-48967883)


Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 76 - 185
Target Start/End: Complemental strand, 48967381 - 48967272
Alignment:
76 ccaacacaattggagaaattgagtggcttaattgatttgaattaaggattagagaataaaaggacctggtctcaaatcttcaaattattagaaaagaatg 175  Q
    |||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48967381 ccaacacaattggagaaattgagtagtttaattgatttgaactaaggattagagaataaaaggacctggtctcaaatcttcaaattattagaaaagaatg 48967282  T
176 atcggtgaac 185  Q
    ||||||||||    
48967281 atcggtgaac 48967272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 48967883 - 48967820
Alignment:
15 aatattcaacacttaaggctaagagactaaaggattgggcttaggtttctacctagcgtgtcca 78  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||    
48967883 aatattcaacacttaaggctaagagactaaaggattgggcttaggtttctatctagcatgtcca 48967820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University