View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4886_low_25 (Length: 203)
Name: NF4886_low_25
Description: NF4886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4886_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 76 - 185
Target Start/End: Complemental strand, 48967381 - 48967272
Alignment:
| Q |
76 |
ccaacacaattggagaaattgagtggcttaattgatttgaattaaggattagagaataaaaggacctggtctcaaatcttcaaattattagaaaagaatg |
175 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48967381 |
ccaacacaattggagaaattgagtagtttaattgatttgaactaaggattagagaataaaaggacctggtctcaaatcttcaaattattagaaaagaatg |
48967282 |
T |
 |
| Q |
176 |
atcggtgaac |
185 |
Q |
| |
|
|||||||||| |
|
|
| T |
48967281 |
atcggtgaac |
48967272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 48967883 - 48967820
Alignment:
| Q |
15 |
aatattcaacacttaaggctaagagactaaaggattgggcttaggtttctacctagcgtgtcca |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
48967883 |
aatattcaacacttaaggctaagagactaaaggattgggcttaggtttctatctagcatgtcca |
48967820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University