View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4887-Insertion-13 (Length: 131)
Name: NF4887-Insertion-13
Description: NF4887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4887-Insertion-13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 1e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 7 - 131
Target Start/End: Complemental strand, 38568943 - 38568822
Alignment:
| Q |
7 |
aatattgggctttttcttacgagaagaagaagattgggggatataccaataaatttcaacctatcaatttcttatttctttcannnnnnnnnnnggtcag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38568943 |
aatattgggctttttcttacgagaagaagaagattggg--atataccaataaatttcaacctatcaatttcttatttctttca-ttttttttttggtcag |
38568847 |
T |
 |
| Q |
107 |
tcttatttctttcattttattgtgc |
131 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38568846 |
tcttatttctttcattttattgtgc |
38568822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University