View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4887_low_10 (Length: 324)
Name: NF4887_low_10
Description: NF4887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4887_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 10 - 145
Target Start/End: Complemental strand, 46220456 - 46220321
Alignment:
| Q |
10 |
ataattcttaccgtaatttttgaattatttaattaatcaacatgggaattgaccagattaactaagctttggcaaccaagtaatggcagtagtgtcttnn |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46220456 |
ataattcttaccgtaatttttgaattatttaattaatcaacatgggaattgaccagattaactaagctttggcaaccaagtaatggcagtagtgtcttaa |
46220357 |
T |
|
| Q |
110 |
nnnnnttaatacatttctaccgtatttttctactat |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46220356 |
aaaaattaatacatttctaccgtatttttctactat |
46220321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 209 - 307
Target Start/End: Complemental strand, 46220257 - 46220159
Alignment:
| Q |
209 |
gatatatgtatcatttattaagaataaataatgggagaatattgttttcatgaagcttaagtcaatcaatatagacaatgtattataatatgtaggatg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46220257 |
gatatatgtatcatttattaagaataaataatgggagaatattgtcttcatgaagcttaagtcaatcaatatagacaatgtattataatatgtaggatg |
46220159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University