View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4887_low_14 (Length: 237)
Name: NF4887_low_14
Description: NF4887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4887_low_14 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 38 - 237
Target Start/End: Original strand, 56005669 - 56005868
Alignment:
| Q |
38 |
gtccactgtccaccataggtgatatgaaagacttccttatcctagaagccaccatttgtataagttgaatacaaaatgaactattcaagtcagtggtttg |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56005669 |
gtccactgtccaccataggtgatatgaaagacttccttatcctagaagccaccatttgtataagttgaatacaaaatgaactattcaagtcagtggtttg |
56005768 |
T |
 |
| Q |
138 |
tctaaaaaccttataactttatgtaatcattgttgcagaaaaagttaaggatgtagcaacttgtcagagtgaaatcaaagcactaaggtcaactgaagct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56005769 |
tctaaaaaccttataactttatgtaatcattgttgcagaaaaagttaaggatgtagcaacttgtcagagtgaaatcaaagcactaaggtcaactgaagct |
56005868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 56005561 - 56005597
Alignment:
| Q |
1 |
cagatcagtgtctcagtcgtgagaacgagtaataccg |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56005561 |
cagatcagtgtctcagtcgtgagaacgagtaataccg |
56005597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University