View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4888-Insertion-1 (Length: 201)
Name: NF4888-Insertion-1
Description: NF4888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4888-Insertion-1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] scaffold0128 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 7 - 193
Target Start/End: Complemental strand, 33809276 - 33809090
Alignment:
| Q |
7 |
actgattcccttcttcttcatactcttccattcttcttcatatttcttaatcgaagcaaactcattcggtatcacttctcgacccgatgaatccgtcgct |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33809276 |
actgattcccttcttcttcttactcttccattcttcttcatatttcttaatcgaagcaaactcattcggtatcacttctcgacccgatgaatgcgtcgct |
33809177 |
T |
|
| Q |
107 |
aattcaaatccttctttcaccgacggcgtcgccaccgaagatattcacatcgatcctttgacctgggtttagcttcttgttaattat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33809176 |
aattcaaatccttctttcaccgacggcgtcgccacaaaagatattcacatcgatcctttgacctgggtttagcttcttgttaattat |
33809090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 7 - 201
Target Start/End: Complemental strand, 39539090 - 39538897
Alignment:
| Q |
7 |
actgattcccttcttcttcatactcttccattcttcttcatatttcttaatcgaagcaaactcattcggtatcacttctcgacccgatgaatccgtcgct |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
39539090 |
actgattctcttcttcttcatactcttccattctt-ttcatatttcttaattgaagcaaactcattcggtatcacttctccacccgaagaatccgtcgct |
39538992 |
T |
|
| Q |
107 |
aattcaaatccttctttcaccgacggcgtcgccaccgaagatattcacatcgatcctttgacctgggtttagcttcttgttaattatgtcatgtg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
39538991 |
aattcaaatccttctttcaccgacggcgttgccaccaaagatattcacatcgatcctttcacctgggtttagcttcttgttaattacgtcatgtg |
39538897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 7 - 201
Target Start/End: Complemental strand, 6306890 - 6306696
Alignment:
| Q |
7 |
actgattcccttcttcttcatactcttccattcttcttcatatttcttaatcgaagcaaactcattcggtatcacttctcgacccgatgaatccgtcgct |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| || |||||||||||| |
|
|
| T |
6306890 |
actgattcccttcttcttcttactcttccattcttcttcatatttcttaaccgaagcaaactcattcagtatcacttctcgacctgaagaatccgtcgct |
6306791 |
T |
|
| Q |
107 |
aattcaaatccttctttcaccgacggcgtcgccaccgaagatattcacatcgatcctttgacctgggtttagcttcttgttaattatgtcatgtg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
6306790 |
aattcaaatccttctttcaccgacggcgtcgccaccaaagatattcacatcgatcctttcaccctggtttagcttcttattaattatgtcatgtg |
6306696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 138; Significance: 2e-72; HSPs: 2)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 20815 - 20630
Alignment:
| Q |
16 |
cttcttcttcatactcttccattcttcttcatatttcttaatcgaagcaaactcattcggtatcacttctcgacccgatgaatccgtcgctaattcaaat |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
20815 |
cttcttcttcacgctcttccattcttcttcatgtttcttaatcgaagcaaactcattcggtatcacttctccacccgaagaatccgtcgctaattcaaat |
20716 |
T |
|
| Q |
116 |
ccttctttcaccgacggcgtcgccaccgaagatattcacatcgatcctttgacctgggtttagcttcttgttaattatgtcatgtg |
201 |
Q |
| |
|
||||||||||||||| || |||||||| |||||||||||||||||||||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
20715 |
ccttctttcaccgacagcatcgccaccaaagatattcacatcgatcctttcgcttggatttagcttcttgttaattatgtcatgtg |
20630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 7 - 45
Target Start/End: Complemental strand, 20847 - 20809
Alignment:
| Q |
7 |
actgattcccttcttcttcatactcttccattcttcttc |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20847 |
actgattcccttcttcttcatactcttcccttcttcttc |
20809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University