View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4888-Insertion-3 (Length: 86)
Name: NF4888-Insertion-3
Description: NF4888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4888-Insertion-3 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 1e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 1e-37
Query Start/End: Original strand, 8 - 86
Target Start/End: Original strand, 46292388 - 46292466
Alignment:
| Q |
8 |
atttgtgatccttcatactaacttgttgttcaatatagaagatgattccctctctttttctttctttctaactttgttt |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46292388 |
atttgtgatccttcatactaacttgttgttcaatatagaagatgattccctctctttttctttctttctaactttgttt |
46292466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University