View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4888_low_4 (Length: 323)
Name: NF4888_low_4
Description: NF4888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4888_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 64 - 300
Target Start/End: Original strand, 24877447 - 24877681
Alignment:
| Q |
64 |
acattcttattatgtgtaattgaatatcgaatcaattatctctatgcatgtctttcaaatttgttaattatattccttttactgtataatttgatttgat |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24877447 |
acattcttattatgtgtaattgaatatcgaatcaattatctctatgcatgtctttcaaatttgttaattatattccttttactgtataatttgatttgat |
24877546 |
T |
 |
| Q |
164 |
cgataaggtttagctttagtggatattagaagttaattatttgggacttgttttagaatcttcatttgttgtaaaatttggtcttattattatgcactat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
24877547 |
cgataaggtttagctttagtggatattagaagttaattatttgggacttgttttagaatcttcatttgttgtaaaatttggtcttattattatgcac--t |
24877644 |
T |
 |
| Q |
264 |
attcaaatttaattggtttcttgcatgagaaatgata |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24877645 |
attcaaatttaattggtttcttgcatgagaaatgata |
24877681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University