View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4889-Insertion-7 (Length: 149)
Name: NF4889-Insertion-7
Description: NF4889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4889-Insertion-7 |
 | |
|
| [»] scaffold0008 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0008 (Bit Score: 89; Significance: 3e-43; HSPs: 2)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 89; E-Value: 3e-43
Query Start/End: Original strand, 8 - 104
Target Start/End: Complemental strand, 65534 - 65438
Alignment:
| Q |
8 |
cttagtcactttatgacacgatttgaaaataaaaacttccttatttgttagctctgaatctgttttaatctgattcctctaaaagatcctcttagaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
65534 |
cttagtcactttatgacacgatttgaaaataagaacttccttatttgttagcactgaatctgttttaatctgattcctctaaaagatcctcttagaa |
65438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 89; E-Value: 3e-43
Query Start/End: Original strand, 8 - 104
Target Start/End: Complemental strand, 73377 - 73281
Alignment:
| Q |
8 |
cttagtcactttatgacacgatttgaaaataaaaacttccttatttgttagctctgaatctgttttaatctgattcctctaaaagatcctcttagaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
73377 |
cttagtcactttatgacacgatttgaaaataagaacttccttatttgttagcactgaatctgttttaatctgattcctctaaaagatcctcttagaa |
73281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University