View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4889-Insertion-9 (Length: 81)
Name: NF4889-Insertion-9
Description: NF4889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4889-Insertion-9 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 3e-35; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 3e-35
Query Start/End: Original strand, 7 - 81
Target Start/End: Complemental strand, 35972887 - 35972813
Alignment:
| Q |
7 |
agaaacaaaccttcgatgttgagtatctgcttgtatttaacaatgtctgattcaagagttgattgcgctgcttga |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35972887 |
agaaacaaaccttcgatgttgagtatctgcttgtatttaacaatgtctgattcaagagttgattgcgctgcttga |
35972813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 10 - 81
Target Start/End: Complemental strand, 35969931 - 35969860
Alignment:
| Q |
10 |
aacaaaccttcgatgttgagtatctgcttgtatttaacaatgtctgattcaagagttgattgcgctgcttga |
81 |
Q |
| |
|
|||| |||||| | ||||||| |||||||| || ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
35969931 |
aacataccttcaaggttgagtttctgcttggatctaacaatgtctgattcatgagttgattgctctgcttga |
35969860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 7 - 81
Target Start/End: Complemental strand, 35952932 - 35952858
Alignment:
| Q |
7 |
agaaacaaaccttcgatgttgagtatctgcttgtatttaacaatgtctgattcaagagttgattgcgctgcttga |
81 |
Q |
| |
|
||||||||||||||| |||||| |||||||||| |||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
35952932 |
agaaacaaaccttcggagttgaggatctgcttgtgtttaacaacctctggttcaagagttgattgtactgcttga |
35952858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University