View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4890-Insertion-15 (Length: 122)
Name: NF4890-Insertion-15
Description: NF4890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4890-Insertion-15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 1e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 7 - 116
Target Start/End: Complemental strand, 24947611 - 24947509
Alignment:
| Q |
7 |
aataatgtcatgaagttctatcattaatcatgcctagaaagtagaaacagaacacttacattcaaatccttcttaatggtttgttttcctctatctaatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24947611 |
aataatgtcatgaagttctatcattaatcatgtctagaaa-------ccgaacacttacattcaaatccttcttaatggtttgttttcctctatctaatt |
24947519 |
T |
|
| Q |
107 |
tttcctcctt |
116 |
Q |
| |
|
|||||||||| |
|
|
| T |
24947518 |
tttcctcctt |
24947509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University