View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4890-Insertion-16 (Length: 106)
Name: NF4890-Insertion-16
Description: NF4890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4890-Insertion-16 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 8e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 8e-40
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 7279142 - 7279240
Alignment:
| Q |
8 |
ccaactccactttcatcttcaaaatcttgttcaaactcgtcctcacaagaaaccctcttgcaaccttctcaatcttcgttgctgaatcggctctgtttc |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
7279142 |
ccaactccactttcatcttcaacatcttgttcaaactcttcctcacaagaaaccctcttgcaaccttctcaatcttcgttgctgaattggctttgtttc |
7279240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 5e-35
Query Start/End: Original strand, 8 - 106
Target Start/End: Complemental strand, 7374697 - 7374599
Alignment:
| Q |
8 |
ccaactccactttcatcttcaaaatcttgttcaaactcgtcctcacaagaaaccctcttgcaaccttctcaatcttcgttgctgaatcggctctgtttc |
106 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
7374697 |
ccaactctaccttcatcttcaacatcttgttcaaactcttcctcacaagaaaccctcttgcaaccttctcaatcttcgttgctgaattggctttgtttc |
7374599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 2e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 12 - 106
Target Start/End: Complemental strand, 5848103 - 5848009
Alignment:
| Q |
12 |
ctccactttcatcttcaaaatcttgttcaaactcgtcctcacaagaaaccctcttgcaaccttctcaatcttcgttgctgaatcggctctgtttc |
106 |
Q |
| |
|
|||||| || |||||||| ||||| ||||||||| ||||||||||||| |||||||||| ||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
5848103 |
ctccaccttgatcttcaacatcttcttcaaactcttcctcacaagaaaacctcttgcaaacttctcaatcttcattgctgagtcggctctgtttc |
5848009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University