View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4890_high_25 (Length: 230)
Name: NF4890_high_25
Description: NF4890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4890_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 35952 - 36148
Alignment:
| Q |
17 |
cacagatatcaaaattgagtatgattcccgtggtttgtgttatggaaaggattcttcacaacaagcacttttcaaggaaagtgaaaatttcagtggtggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35952 |
cacagatatcaaaattgagtatgattcccgtggtttgtgttatggaaaggattcttcacaacaagcacttttcaaggaaagtgaaaatttcagtggtggt |
36051 |
T |
 |
| Q |
117 |
tgtggttattggtgttggtgtttgtaccgtaactgatgtaaaagttaacctcacaggtttcacatgtgcatgtttagcagttttctctacatctttg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36052 |
tgtggttattggtgttggtgtttgtaccgtaactgatgtaaaagttaacctcaaaggtttcacatgtgcatgtttagcagttttctctacatctttg |
36148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 176
Target Start/End: Complemental strand, 8676696 - 8676538
Alignment:
| Q |
18 |
acagatatcaaaattgagtatgattcccgtggtttgtgttatggaaaggattcttcacaacaagcacttttcaaggaaagtgaaaatttcagtggtggtt |
117 |
Q |
| |
|
||||||||||||| | || |||||||| ||||||||||| |||||| |||| ||||||| ||| |||| |||||| |||||||| | || || ||||| |
|
|
| T |
8676696 |
acagatatcaaaactaagcatgattccggtggtttgtgtgatggaatggatccttcacagcaaacactactcaagggaagtgaaagtgtcggtcatggtt |
8676597 |
T |
 |
| Q |
118 |
gtggttattggtgttggtgtttgtaccgtaactgatgtaaaagttaacctcacaggttt |
176 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
8676596 |
gtggttattggtgttggtgtttgcaccgtaactgatgtaaatgttaacttcaaaggttt |
8676538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University