View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4890_low_18 (Length: 353)
Name: NF4890_low_18
Description: NF4890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4890_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 24 - 337
Target Start/End: Complemental strand, 52113948 - 52113653
Alignment:
| Q |
24 |
tcatttcaccaatctccaaaaagtttcacacccgagcaacaacaacaacaatggcttcaacttccacaatttcaatggctgtgccattaacctgtgccag |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113948 |
tcatttcaccaatctccaaaaagtttcacacccgagcaacaacaa------tggcttcaacttccacaatttcaatggctgtgccattaacctgtgccag |
52113855 |
T |
 |
| Q |
124 |
caagaagctagaggcaccaacctctcaagcattcttgaaggcaccattgactctgaagccatcaaagtctgtggcagcatcaaaccataacgcaaggttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52113854 |
caagaagctagaggcaccaacctctcaagcattcttgaaggcaccattgactctgaagccatcaaagtctgtggcagca------------gcaaggttt |
52113767 |
T |
 |
| Q |
224 |
gtagtgaaagcatccttgaaagagaaaattgtgacaggtttaactgcagctgcattgacagcttcaatgatttctcctgatgtggctgaagctgctactg |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113766 |
gtagtgaaagcatccttgaaagagaaaattgtgacaggtttaactgcagctgcattgacagcttcaatgatttctcctgatgtggctgaagctgctactg |
52113667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University