View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4890_low_23 (Length: 304)

Name: NF4890_low_23
Description: NF4890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4890_low_23
NF4890_low_23
[»] chr8 (3 HSPs)
chr8 (16-152)||(143884-144034)
chr8 (250-286)||(143786-143822)
chr8 (168-202)||(143852-143886)


Alignment Details
Target: chr8 (Bit Score: 96; Significance: 4e-47; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 16 - 152
Target Start/End: Complemental strand, 144034 - 143884
Alignment:
16 atgaggcgttttccattgagggaaaatgagatgaggttaaagatcaaacatattacatatgcgagaagaaaacaacaacgaagcataa------------ 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                
144034 atgaggcgttttccattgagggaaaatgagatgaggttaaagatcaaacatattacatatgcgagaagaaaacaacaacgaagcataagcgtgagatgct 143935  T
104 --acaacaatgatagtgtttaattcgtatagatggaagtcctattttcaca 152  Q
       | ||||||||||||||||||||||||||||||||||||||||||||||    
143934 atgctacaatgatagtgtttaattcgtatagatggaagtcctattttcaca 143884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 250 - 286
Target Start/End: Complemental strand, 143822 - 143786
Alignment:
250 tttcatacatgatttaatcaccagcatctgtactatg 286  Q
    |||||||||||||||||||||||||||||||||||||    
143822 tttcatacatgatttaatcaccagcatctgtactatg 143786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 168 - 202
Target Start/End: Complemental strand, 143886 - 143852
Alignment:
168 acaacggcaaagaattctacatgtgaaaatcaatt 202  Q
    |||||||||||||||||||||||||||||||||||    
143886 acaacggcaaagaattctacatgtgaaaatcaatt 143852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University