View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4890_low_29 (Length: 238)
Name: NF4890_low_29
Description: NF4890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4890_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 12 - 220
Target Start/End: Complemental strand, 37405005 - 37404796
Alignment:
| Q |
12 |
aagaatattagaagctttgccaaaatagaaatctgtccgggcgtggaacttttgtgacataagccggcaatgtgtcgtgttcaaggtcagatgtttctat |
111 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37405005 |
aagaatattagaagctttaccaaaatagaaatctgtccgggcgtggaacttttgtgacataagccggcaatgtgtcgtgttcaaggtcggatgtttctat |
37404906 |
T |
 |
| Q |
112 |
gaaaggtagat-tttcccatctctttctctcatggaatcctcctctttttgtaatatttttccgaacatatagatgatggaccaaacacccttccatggc |
210 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37404905 |
gaaaggtagatgaatcccatctctttctctcaaggaatcctcctctttttgtaatatttttccgaacatatagatgatggaccaaacacccttccatggc |
37404806 |
T |
 |
| Q |
211 |
atggctataa |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
37404805 |
atggctataa |
37404796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University