View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4891-Insertion-11 (Length: 110)
Name: NF4891-Insertion-11
Description: NF4891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4891-Insertion-11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 1e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 11 - 85
Target Start/End: Original strand, 53682952 - 53683026
Alignment:
| Q |
11 |
ttcaccgattccattttctaaaattactatcgatgtcaatgtcgtgtctacatcaccaaattaatgtcctaatga |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53682952 |
ttcaccgattccattttctaaaattactatcgatgtcaatgtcgtgtctacatcaccaaattaatgttctaatga |
53683026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 24 - 55
Target Start/End: Original strand, 26471356 - 26471387
Alignment:
| Q |
24 |
ttttctaaaattactatcgatgtcaatgtcgt |
55 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |
|
|
| T |
26471356 |
ttttctcaaattactatcgatgtcaatgtcgt |
26471387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University